0957 2289 For HP Deskjet F2488 F4288 F2410 J4580 J4660 J4500 Printer 01908 32V 625mA AC Power Supply Adapter in Printer Parts from Computer Office

0957 2289 For HP Deskjet F2488 F4288 F2410 J4580 J4660 J4500 Printer 01908 32V 625mA AC Power Supply Adapter in Printer Parts from Computer Office
0957 2289 For HP Deskjet F2488 F4288 F2410 J4580 J4660 J4500 Printer 01908 32V 625mA AC Power Supply Adapter in Printer Parts from Computer Office
0957 2289 For HP Deskjet F2488 F4288 F2410 J4580 J4660 J4500 Printer 01908 32V 625mA AC Power Supply Adapter in Printer Parts from Computer Office

Product Specification

Brand Name: vilaxh

Model Number: For HP J4580

Type: Other

Quantity: 1pcs

AC Power: 0957-2289



Original AC Power Adapter for HP Printer  Universal AC Input 
  Efficiency: >80% @full load typical 
  High MTBF & Long life 
  EMI/FRI: FCC part 15, subpart B Class B
  Over voltage protection 
  Overload protection 
  Short CKT protection 
  Over temperature Protection


Input: 200-240V 
  Output: 32v 625mA DC 
   DC Output Connector:3-Prong

  100% satisfaction guarantee

Condition: 100% New Genuine

Package Content:
1 pcs AC Power Adapter Charger
Packaging Type:
 box packaging
Printer model:


 For HP Deskjet F2488 F4288 F2410 J4580 J4660 J4500









1) We accept Alipay, West Union, TT. All major credit cards are accepted through secure payment processor ESCROW.

2) Payment must be made within 3 days of order.

3) If you can't checkout immediately after auction close, please wait for a few minutes and retry Payments must be completed within 3 days.



1. WORLDWIDE SHIPPING. (Except some countries and APO/FPO)

2. Orders processed timely after the payment verification.

3. We only ship to confirmed order addresses. Your order address MUST MATCH your Shipping address.

4. The images shown are not the actual item and are for your reference only.

5. SERVICE TRANSIT TIME is provided by the carrier and excludes weekends and holidays. Transit times may vary, particularly during the holiday season.

6. If you have not received your shipment within 30 days from payment, please contact us. We will track the shipment and get back to you as soon as possible with a reply. Our goal is customer satisfaction!

7. Due to stock status and time differences, we will choose to ship your item from our first available warehouse for fast delivery.


1. You have 7 days to contact us and 30 days to return it from the date it was received. If this item is in your possession more than 7 days, it is considered used and WE WILL NOT ISSUE YOU A REFUND OR REPLACEMENT. There are NO EXCEPTIONS! Shipping cost is bear by both seller and buyer in half.

2. All returned items MUST BE in the original packaging and you MUST PROVIDE us with the shipping tracking number, specific reason for the return, and your po#.

3. We will refund YOUR FULL WINNING BID AMOUNT, upon receipt of the item in its original condition and packaging with all components and accessories included, AFTER BOTH Buyer and Seller cancel the transaction from aliexpress. OR, you may choose to have a replacement.

4. We will bear all the shipping cost if the product(s) is (are) not as advertised.



1. 15days Manufacturer`s limited Warranty for defective items (excluding items damaged and/or misused after receipt). Accessories come with a 3-month warranty.

2. Defective items MUST BE reported and returned within the warranty period (and in the original packaging, if possible). You must tell us what the defect is and give us your order number. WE DO NOT REPAIR OR REPLACE ITEMS WITH AN EXPIRED WARRANTY.

You agree to all of the above-listed policies upon ordering on aliexpress!



We maintain high standards of excellence and strive for 100% customer satisfaction! Feedback is very important We request that you contact us immediately BEFORE you give us neutral or negative feedback, so that we can satisfactorily address your concerns.

It is impossible to address issues if we do not know about them


If you has any question and online contact us or email for us .;-)


KFD 32V 1560mA AC Adapter for HP 0957-2230 ... - Amazon.com

Buy KFD 32V 1560mA AC Adapter for HP 0957-2230 0957-2271 0957-2105 0957-2259 0950-4476 0957-2289 0957-2242 0957-2269; HP 6000 6500 6800 ...

0957 2269 0957 2242 0957 2289 AC Power Adapter Charger ...

Cheap Printer Parts, Buy Directly from China Suppliers:0957-2269 0957-2242 0957-2289 AC Power Adapter Charger Supply 32V 625mA for HP D1650 D1658  ...

TFDirect 32V AC Adaptor for HP Printer Adapter 0957 ... - Amazon.com

TFDirect 32V AC Adaptor for HP Printer Adapter 0957-2105,0957-2271,0957- 2269,0957-2286,0957-2230,0957-2242,0957-2290,0950-4476,0957-2289 ...

32V 625MA 0957 2269 0957 2289 0957 2242 AC Power Adapter ...

Cheap Printer Parts, Buy Directly from China Suppliers:32V 625MA 0957-2269 0957-2289 0957-2242 AC Power Adapter Charger For HP F2418 F4488 F2460 ...

TFDirect 32V HP Printer Adapter 0957-2271,0957 ... - Amazon.com

Buy TFDirect 32V HP Printer Adapter 0957-2271, 0957-2269, 0957-2286 for HP ... 0957-2286 , 0957-2289 , 0957-2290 , 0957-2398 , AA24510L , HP 7500A ...

Buy 32V 625mA AC Adapter For HP Printer 0957-2269 0957-2242 ...

Buy 32V 625mA AC Adapter For HP Printer 0957-2269 0957-2242 0957-2289 Power Supply online at a discounted price from ShopClues.com. Shop Mobile ...

AC DC Adapter Power For HP Deskjet Officejet 0957-2289 F4280 ...

HP Deskjet Officejet F4280 J4580 C7280 C4795. Output: DC 32V--625mA. Input: AC 100-240V, 50-60Hz. 2.5ft US power cord included. Just give us the ...

32V 625mA 0957-2242 / 2250 / 2269 /2289 HP Printer Adapter ...

Over temperature protection input:100~240V 50/60hz 600mA Output:32v 625ma 0957-2242 / 0957-2250 / 0957-2269 /0957-2289 This Adapter Same Support ...

ABLEGRID 32V 625mA AC Adapter for HP Printer 0957-2269 2289 ...

Free Shipping on orders over $35. Buy ABLEGRID 32V 625mA AC Adapter for HP Printer 0957-2269 2289 0957-2242 Power Cord at Walmart.com.

32V 1560mA AC Adapter Power Supply Charger Cord for HP 0957 ...

32V 1560mA AC Adapter Power Supply Charger Cord for HP 0957-2230 0957- 2271 0957-2105 0957-2259 0950-4476 0957-2289 0957-2242 0957-2269; HP ...

T-Power ( TM ) 32v for HP Deskjet Ink Advantage All-in-One Series ...

... 0957-2286 , 0957-2289 , 0957-2290 , 0957-2398 , AA24510L , HP 7500A K20 ... AC DC Adapter HP 0957-2403 0957-2385 22V 455mA Power Supply AC ...


HP PRINTER ADAPTER 0957-2289 32V 625mA... Detail · HP PRINTER ADAPTER 0... HP PRINTER ADAPTER 0957-2286 30V 333mA... Detail ...

power hp | eBay Mobile

HP 0957-2290+30V 333mA printer Adapter(Original Power Adapter With Power ... 32V 625mA AC Adapter For HP Printer 0957-2269 0957-2242 0957-2289 ...

2019 0957 2269 0957 2259 0957 2271 0957 2230 0957 2289 0957 ...

Wholesale cheap 0957-2269 brand -0957-2269 0957-2259 0957-2271 0957- 2230 0957-2289 0957-2242 for hp printer ac adapter power supply charger 32v ...

New 32V 625mA 20W AC Power Supply Adapter 0957-2242 0957 ...

... 20W AC Power Supply Adapter 0957-2242 0957-2269 Compatible with HP ... 0957-2289, 0957-2269; HP Photosmart B109D B109Q HP DeskJet F4580;HP ...

Wireless Charger Supplying UK

wireless charger supplying UK - Printer Ac Power Adapter Charger for Hp Officejet ... G510n Deskjet 6940 32v 625MA 0957-2242 2289 2269 Power Supply .

Gene sequences

... gtggcaggtttcctggaactagttgaggtgctgctgcgcgatcgcgcttag >syc0957_c hypothetical protein ...... >syc2289_d hypothetical protein ...

1. Introduction

... 2665 2669 2-s2.0-26444490982 10.1088/0957-4484/16/11/033 9 Hu J. Q. Li Q . .... 2-s2.0-38149053931 42 Cong H. P. Yu S. H. Hybrid ZnO-dye hollow spheres .... 84 4 2287 2289 10.1063/1.368295 2-s2.0-0005820442 79 Cross R. B. M. de ...

Items where Subject is "Engineering > MIT Manipal > Aeronautical ...

ISSN 2289-7879 ..... Chandrakant R and Sharma, Yagnesh N (2017) FSI Analysis of trailing edge region cooling in hp stage turbine blade. ..... ISSN 0957- 4522.

Items where Year is 2017 - Universiti Teknologi Malaysia ...

ISSN 2289-7887 .... Behbahani, H. P. and Adnan, A. and Vafaei, M. and Shad, H. and Pheng, O. P. (2017) Vibration mitigation of structures .... ISSN 0957-5820.



Who's who?

... 2001#2 V2289 Cyg = Cyg 2 = USNO-A2.0 1350-10742181 = 1933+5100 (H, .... USNO-A2.0 0600-17903832 HP Lib = GSC 5608.1089 = Lib 5 = USNO-A2.0 ..... J0043+4107 BPM 6114 -> 0957-6639 BPM 6502 -> 1042-6902 BPM 31582 ...

Customs Entries December 2013 HS Codes Beginning with 85 to 97

KWHP, 5,248.00, 4,823.00, 1,590.13, USD, 68.77, USD, 63.61, USD ...... Static converters, - - - Other, SINGAPORE, SINGAPORE, 0957-2320, 1.00, 1.00, 646.90 ...... 2289, 000019260, 85119090000, Electrical ignition/starting equipment for ...

eCite Browse by School

ISSN 0957-5820 (2019) [Refereed Article] ... ISSN 0957-5820 (2018) [Refereed Article] ...... ISSN 0273-2289 (2014) [Refereed Article] ...... Nguyen, HD and Nguyen, HP and Hoang, GH, GNSS - Current Status and Applications in Automation in ...

Sugarcane Bagasse

Aug 9, 2011 ... ... used has a 250 mm diameter, exit dimension of 40 mm, one ¾ HP (1 HP = ..... 105-116, ISSN 0273-2289 .... pp.197-212, ISSN 0957-4352.

Commetns gdk-gulkevichi.ru :